Table of Contents  
ORIGINAL ARTICLE
Year : 2015  |  Volume : 14  |  Issue : 1  |  Page : 15-29

Synthesis, cytotoxic, proapoptotic evaluation, and molecular docking study of some new N-substituted sulfonyl-3-indolyl heterocycles


1 Department of Natural Compounds Chemistry, National Research Centre, Dokki, Giza, Egypt
2 Department of Hormones, National Research Centre, Dokki, Giza, Egypt

Date of Submission06-Aug-2014
Date of Acceptance09-Sep-2014
Date of Web Publication8-Apr-2015

Correspondence Address:
Eslam R El-Sawy
Chemistry Department of Natural Compounds, National Research Centre, Dokki 12311, Giza
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1687-4315.154695

Rights and Permissions
  Abstract 

Background and objectives
Apoptosis, also called programmed cell death, is a fundamental biological phenomenon that plays a crucial role in processes such as immune regulation, embryogenesis, and general tissue homeostasis. B-cell lymphocyte/leukemia-2 (BCL-2) family members are key regulators of apoptosis. The ability of the indole derivative to disrupt microtubule assembly and induce G2/M arrest, polyploidy, and apoptosis through mitochondrial pathways in COLO 205 cell has been reported; in addition, it reduced the levels of procaspase-3, procaspase-9, BCL-xL, and BCL-2 gene. The aim of this study is to describe the synthesis of some new N-substituted sulfonyl-3-indolyl heterocycles and to study their cytotoxic and proapoptotic effects. In addition, a molecular docking study of the most biologically active compounds against the BCL-2 protein is discussed.
Materials and methods
A new series of triazolopyridines 3a-c , diaminopyridines 4a-c , acetamides 5a-c , triazolo[1,5-a]pyridines 6a-c-8a-c , pyrido[1,2-b][1,2,4]triazines 9a-c , 10a-c , pyrazoles 11a-c, 12a-c , and pyrimidine derivatives 13a-c-15a-c were prepared by an initial reaction of 2-((N-substituted sulfonyl-1H-indol-3-yl)methylene) malononitriles 2a-c with different reagents. The newly synthesized compounds were tested for their cytotoxic activity against the HepG2 cell line. The compounds that showed promising IC 50 values were chosen for the study of their proapoptotic effect on the BCL-2 gene, which is an antiapoptotic factor, and they significantly inhibited the expression levels of the BCL-2 gene. The binding mode of the most promising proapoptotic compounds was assessed by docking studies with the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L).
Results and conclusion
From the data obtained, the most active compounds against the HepG2 cancer cell line were in the descending order of 10b>4c>10a>10c , whereas compounds 3c , 6c , 9c , 4b , and 5c showed moderate to slight growth inhibition. Compounds 4c , 5c , 9c , 10a , 10b , and 10c significantly inhibited the expression levels of the BCL-2 gene. Docking results showed that compounds 5c and 9c showed good fitting within the pocket site of the protein molecular surface and had a minimum binding energy of −20.29 and −18.98 kJ/mol, respectively, in comparison with the co-crystallized ligand, which is in agreement with the experimental result of a proapoptotic effect.

Keywords: Cytotoxic and proapoptotic activities, indole-3-carboxaldehyde, molecular docking, pyrazole, pyridine, pyrimidine


How to cite this article:
El-Sawy ER, Abo-Salem HM, Yahya SM, Ebaid MS, Mandour AH. Synthesis, cytotoxic, proapoptotic evaluation, and molecular docking study of some new N-substituted sulfonyl-3-indolyl heterocycles. Egypt Pharmaceut J 2015;14:15-29

How to cite this URL:
El-Sawy ER, Abo-Salem HM, Yahya SM, Ebaid MS, Mandour AH. Synthesis, cytotoxic, proapoptotic evaluation, and molecular docking study of some new N-substituted sulfonyl-3-indolyl heterocycles. Egypt Pharmaceut J [serial online] 2015 [cited 2020 Mar 29];14:15-29. Available from: http://www.epj.eg.net/text.asp?2015/14/1/15/154695


  Introduction Top


Apoptosis, also called programmed cell death, is a fundamental biological phenomenon that plays a crucial role in processes such as immune regulation, embryogenesis, and general tissue homeostasis. B-cell lymphocyte/leukemia-2 (BCL-2) family members are key regulators of apoptosis. The first group of genes in this family, which contains the BCL-2 gene and the BCL-2-like 1 isoform gene (BCL-xL), possesses antiapoptotic activity. The second group, which is comprised of proteins such as the BCL-2-associated X protein gene (Bax) and the BCL-2-antagonist killer gene (Bak), promotes cell death, thus carrying proapoptotic activity. The BCL-2 gene was discovered by virtue of its translocation into the immunoglobulin heavy-chain locus in follicular B-cell lymphoma [1]. BCL-2 gene, which is expressed in certain tumor cells, was identified as an important factor in regulating apoptosis [2]. Overexpression of the BCL-2 gene has been shown to promote cell survival [3]. However, functionalized nitrogen heterocycles play a predominant role in medicinal chemistry and they have been used intensively as scaffolds for drug development. The pyridine, pyrimidine, and pyrazole nucleus are known for their pronounced pharmaceutical activities namely antitumor, anti-inflammatory, and antimicrobial activities [4],[5],[6],[7],[8],[9],[10],[11],[12]. In addition, indole which is the potent basic pharmacodynamic nucleus, has been reported to possess a wide variety of biological properties namely, antimicrobial, anti-inflammatory, anticancer, and antioxidant [13],[14],[15],[16],[17]. In the present work and in continuation of our search [18],[19],[20],[21] for the preparation of new polyheterocycles with pharmaceutical value, here, we report the synthesis of some new N-substituted sulfonyl-3-indolyl heterocycles and study their cytotoxic and proapoptotic effects. In addition, molecular docking studies of the most biologically active compounds against BCL-2 protein have been carried out.


  Experimental Top


Chemistry

Melting points were determined in open capillary tubes on an Electrothermal 9100 digital melting point apparatus (serial No. 8694; Electrothermal Engineering Ltd, Rochford, UK) and were uncorrected. Elemental analyses were carried out on a Perkin-Elmer 2400 analyzer (Perkin-Elmer, Waltham, Massachusetts, USA) and were found to be within ±0.4% of the theoretical values. Infrared (IR) spectra were recorded on a Perkin-Elmer 1600 FTIR spectrophotometer in KBr discs. The 1 H NMR spectra were measured using a Bruker Avance digital spectrometer 500 MHz (BRUKER BioSpin GMBH, Rheinstetten, Germany) in dimethyl sulfoxide (DMSO)-d6 , and chemical shifts were recorded in δ ppm relative to trimethylsilane as an internal standard. Mass spectra (EI) were run at 70 eV using a JEOL-JMS-AX500 mass spectrometer (Jeol Ltd, Tokyo, Japan). N-methylsulfonyl ( 1a ), N-benzenesulfonyl ( 1b ) N-(4-chlorobenzenesulfonyl) indole-3-carboxaldehydes ( 1c ), and 2-(N-benzenesulfonyl-1H-indol-3-ylmethylene) malononitrile ( 2b ) were prepared as reported [22],[23],[24],[25].

Synthesis of 2a and 2c

To a solution of 1a or 1c (0.01 mol) in absolute ethanol (10 ml) containing piperidine (0.2 ml), malononitrile (0.66 g, 0.01 mol) was added. The reaction mixture was stirred for 30 min at room temperature and the precipitate formed was filtered off, washed with absolute ethanol, air dried, and crystallized from absolute ethanol to yield 2a or 2c , respectively.

2-((N-(methansulfonyl)-1H-indol-3-yl)methylene)malononitrile 2a ; melting point 189-191°C; yield 96%. IR (KBr): υ = 2207 (CN), 1625 (C=C), 1386 and 1136 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 3.12 (s, 3H, SO 2 CH 3 ), 7.13-7.40 (m, 4H, Ar-H), 7.63 (1H, s, CH=C), 8.08 (s, 1H, indolyl 2-H). C 13 H 9 N 3 O 2 S (271.29): calcd. C 57.55; H 3.34; N 15.49; found C 57.42; H 3.25; N 15.38.

2-((N-(4-chlorophenylsulfonyl)-1H-indol-3-yl)methylene) malononitrile 2c ; melting point 208-110°C; yield 96%. IR (KBr): υ = 2195 (CN), 1575 (C=C), 1378 and 1154 (SO 2 -N), 745 cm -1 (C-Cl). 1 H NMR (DMSO-d6) δ: 7.11-7.53 (m, 9H, Ar-H), 7.84 (1H, s, CH=C), 8.34 (s, 1H, indolyl 2-H). C 18 H 10 ClN 3 O 2 S (367.81): calcd. C 58.78; H 2.74; N 11.42; found C 58.62; H 2.81; N 11.32.

Synthesis of 3a, 3b, and 3c

To a solution of compound 2a , 2b , or 2c (0.02 mol) in absolute ethanol (50 ml) containing triethylamine (0.5 ml), 2'-acetyl-2-cyanoacetohydrazide (0.28 g, 0.02 mol) was added. The reaction mixture was heated under reflux for 20-24 h. The solvent was evaporated under vacuum to about half the bulk of its volume and set aside in a refrigerator overnight. The precipitate formed was filtered off, washed with water, air dried, and crystallized from acetonitrile.

7-(N-methanesulfonyl-1H-indol-3-yl)-2-methyl-5-oxo-3,5-dihydro [1, 2, 4] triazolo [1,5-a]pyridine-6,8-dicarbonitrile 3a ; melting point 93-95°C; yield 30%. IR (KBr): υ = 3326 (NH), 2210 (CN), 1730 (C=O), 1604 (C=N), 1566 (C=C), 1377 and 1158 cm−1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 2.17 (s, 3H, CH 3 ), 3.82 (s, 3H, SO 2 CH 3 ), 7.12-7.48 (m, 4H, Ar-H), 8.12 (s, 1H, NH), 8.27 (s, 1H, indolyl 2-H). EI-MS: m/z (%) = 392 (M + , 0.01). C 18 H 12 N 6 O 3 S (392.39): calcd. C 55.10; H 3.08; N 21.42; found C 55.24; H 2.92; N 21.26.

7-(N-benzenesulfonyl-1H-indol-3-yl)-2-methyl-5-oxo-3,5-dihydro [1, 2, 4] triazolo [1,5-a]pyridine-6,8-dicarbonitrile 3b ; melting point 173°C; yield 25%. IR (KBr): υ = 3324 (NH), 2212 (CN), 1704 (C = O), 1620 (C=N), 1522 (C = C), 1368 and 1175 cm−1 (SO 2 -N). EI-MS: m/z (%) = 454 (M + , 0.01). C 23 H 14 N 6 O 3 S (454.46): calcd. C 60.79; H 3.11; N 18.49; found C 60.64; H 3.24; N 18.35.

7-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl)-2-methyl-5-oxo-3,5-dihydro [1, 2, 4]triazolo [1,5-a]pyridine-6,8-dicarbonitrile 3c ; melting point 141-143°C; yield 37%. IR (KBr): υ = 3325 (NH), 2212 (CN), 1703 (C=O), 1618 (C=N), 1522 (C=C), 1376 and 1176 (SO 2 -N), 748 cm−1 (C-Cl). 1 H NMR (DMSO-d6) δ: 1.19 (s, 3H, CH 3 ), 7.16-8.13 (m, 8H, Ar-H), 8.26 (s, 1H, indolyl 2-H), 8.78 (s, 1H, NH). C 23 H 13 ClN 6 O 3 S (488.91): calcd. C 56.50; H 2.68; N 17.19; found C 56.37; H 2.51; N 17.05.

Synthesis of compounds 4a, 4b, and 4c

A mixture of compound 2a , 2b , or 2c (5.0 mmol) and 2-cyanoacetic acid hydrazide (0.49 g, 5.0 mmol) in dry ethanol (50 ml) containing piperidine (0.1 ml) was heated under reflux for 6-8 h. After cooling, the solid formed was filtered off, washed with water, air dried, and crystallized from absolute ethanol.

1,6-diamino-4-(N-methanesulfonyl-1H-indol-3-yl)-2-oxo-1,2-dihydropyridine-3,5-dicarbonitrile 4a ; melting point 126-128°C; yield 89%. IR (KBr): υ = 3429 and 3317 (NH 2 ), 2206 (CN), 1715 (C=O), 1652 (C=C), 1338 and 1174 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 1.14 (s, 2H, NH 2 ), 3.73 (s, 3H, SO 2 CH 3 ), 7.16-7.65 (m, 4H, Ar-H), 8.25 (s, 1H, indolyl 2-H), 12.11 (s, 2H, NH 2 ). EI-MS: m/z (%) = 368 (M + , 13.13). C 16 H 12 N 6 O 3 S (368.37): calcd. C 52.17; H 3.28; N 22.81; found C 52.05; H 3.17; N 22.63.

1,6-diamino-4-(N-benzensulfonyl-1H-indol-3-yl)-2-oxo-1,2-dihydropyridine-3,5-dicarbonitrile 4b ; melting point 206-208°C; yield 81%. IR (KBr): υ = 3402 and 3299 (NH 2 ), 2210 (CN), 1661 (C=O), 1592 (C=C), 1353 and 1162 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 2.96 (s, 2H, NH 2 ), 7.13-8.02 (m, 9H, Ar-H), 8.26 (s, 1H, indolyl 2-H), 11.88 (s, 2H, NH 2 ). EI-MS: m/z (%) = 430 (M + , 0.01). C 21 H 14 N 6 O 3 S (430.44): calcd. C 58.60; H 3.28; N 19.52; found C 58.47; H 3.16; N 19.36.

1,6-diamino-4-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl)-2-oxo-1,2-dihydro-pyridine-3,5-dicarbonitrile 4c ; melting point 159-161°C; yield 93%. IR (KBr): υ = 3419 and 3195 (NH 2 ), 2210 (CN), 1714 (C=O), 1577 (C=C), 1375 and 1123 (SO 2 -N), 747 cm -1 (C-Cl). 1 H NMR (DMSO-d6) δ: 1.60 (s, 2H, NH 2 ), 2.98 (s, 2H, NH 2 ), 7.16-8.17 (m, 8H, Ar-H), 8.32 (s, 1H, indolyl 2-H). EI-MS: m/z (%) = 464/466 (M + /M + +2, 0.14/0.04). C 21 H 13 ClN 6 O 3 S (464.88): calcd. C 54.26; H 2.82; N 18.08; found C 54.08; H 2.93; N 17.94.

Synthesis of compounds 5a, 5b, and 5c

A suspension of compound 4a , 4b , or 4c (0.02 mol) in acetic anhydride (10 ml) was heated under reflux for 8-10 h until TLC showed the absence of the starting materials. After cooling, the reaction mixture was poured onto water (20 ml) and the solid formed was filtered off, washed with water, air dried, and crystallized from absolute ethanol.

N-[6-acetylamino-3,5-dicyano-4-(N-methanesulfonyl-1H-indol-3-yl)-2-oxo-2H-pyridin-1-yl]acetamide 5a ; melting point 245°C; yield 30%. IR (KBr): υ = 3324 and 3206 (NH), 2210 (CN), 1705 and 1689 (C=O), 1612 (C=C), 1386 and 1175 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 1.23 (s, 3H, CH 3 ), 1.65 (s, 3H, CH 3 ), 3.85 (s, 3H, SO 2 CH 3 ), 7.06-7.75 (m, 4H, Ar-H), 8.03 (s, 1H, indolyl 2-H), 9.05 (s, 1H, NH), 10.21 (s, 1H, NH). EI-MS: m/z (%) = 452 (M + , 2.45). C 20 H 16 N 6 O 5 S (452.44): calcd. C 53.09; H 3.56; N 18.57; found C 52.94; H 3.38; N 18.41.

N-[6-acetylamino-3,5-dicyano-4-(N-benzenesulfonyl-1H-indol-3-yl)-2-oxo-2H-pyridin-1-yl]acetamide 5b ; melting point 134-136°C; yield 44%. IR (KBr): υ = 3284 and 3175 (NH), 2207 (CN), 1710, 1702 and 1645 (C=O), 1564 (C=C), 1365 and 1163 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 1.12 (s, 3H, CH 3 ), 1.96 (s, 3H, CH 3 ), 5.63 (s, 1H, NH), 7.11-7.92 (m, 9H, Ar-H), 8.21 (s, 1H, indolyl 2-H), 8.65 (s, 1H, NH). C 25 H 18 N 6 O 5 S (514.51): calcd. C 58.36; H 3.53; N 16.33; found C 58.21; H 3.36; N 16.19.

N-[6-acetylamino-3,5-dicyano-4-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl)-2-oxo-2H-pyridin-1-yl]acetamide 5c ; melting point 98-100°C; yield 31%. IR (KBr): υ = 3327 and 3219 (NH), 2220 (CN), 1705 and 1672 (C=O), 1595 (C=C), 1387 and 1153 (SO 2 -N), 754 cm -1 (C-Cl). 1 H NMR (DMSO-d6) δ: 2.44 and 2.56 (2s, 6H, 2COCH 3 ), 3.63 (s, 1H, NH), 7.11-8.52 (m, 9H, Ar-H), 11.90 (s, 1H, NH). EI-MS: m/z (%) = 548/550 (M + /M + +2, 3.52/1.14). C 25 H 17 ClN 6 O 5 S (548.96): calcd. C 54.70; H 3.12; N 15.31; found C 54.54; H 3.26; N 15.21.

Synthesis of compounds 6a, 6b, and 6c

A mixture of compound 4a , 4b , or 4c (0.01 mol) and excess of carbon disulfide (10 ml) in an absolute ethanolic potassium hydroxide solution [ethanolic KOH 1 mol/l (20 ml)] was heated under reflux for 12 h. The excess carbon disulfide was evaporated under vacuum and the residue obtained was dissolved in water (20 ml). The reaction mixture was filtered off and the filtrate was acidified with diluted hydrochloric acid (1: 1). The solid that formed was filtered off, washed with water, air dried, and crystallized from dimethylformamide-water.

7-(N-methanesulfonyl-1H-indol-3-yl)-5-oxo-2-thioxo-1, 2, 3, 5-tetrahydro [1, 2, 4] triazolo [1,5-a]pyridine-6,8-dicarbonitrile 6a ; melting point 231-233°C; yield 91%. IR (KBr): υ = 3279 (NH), 2219 (CN), 1725 (C=O), 1568 (C=C), 1384 and 1148 (SO 2 -N), 1240 cm -1 (C=S). 1 H NMR (DMSO-d6) δ: 3.82 (s, 3H, SO 2 CH 3 ), 7.16-8.01 (m, 4H, Ar-H), 8.29 (s, 1H, indolyl 2-H), 8.68 (s, 1H, NH), 11.87 (s, 1H, NH). EI-MS: m/z (%) = 410 (M + , 0.38). C 17 H 10 N 6 O 3 S 2 (410.43): calcd. C 49.75; H 2.46; N 20.48; found C 49.56; H 2.31; N 20.52.

7-(N-benzenesulfonyl-1H-indol-3-yl)-5-oxo-2-thioxo-1, 2, 3, 5-tetrahydro [1, 2, 4] triazolo [1,5-a]pyridine-6,8-dicarbonitrile 6b ; melting point 173-175°C; yield 92%. IR (KBr): υ = 3327 (br. NH), 2208 (CN), 1705 (C=O), 1605 (C=C), 1372 and 1175 (SO 2 -N), 1245 cm -1 (C=S). 1 H NMR (DMSO-d6) δ: 7.02-7.75 (m, 9H, Ar-H), 8.25 (s, 1H, indolyl 2-H), 11.87 (s, 1H, NH), 12.02 (s, 1H, NH). EI-MS: m/z (%) = 472 (M + , 0.14). C 22 H 12 N 6 O 3 S 2 (472.50): calcd. C 55.92; H 2.56; N 17.79; found C 55.77; H 2.41; N 17.65.

7-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl)-5-oxo-2-thioxo-1, 2, 3, 5-tetrahydro [1, 2, 4]triazolo [1,5-a]pyridine-6,8-dicarbonitrile 6c ; melting point 179-181°C; yield 88%. IR (KBr): υ = 3312 and 3233 (NH), 2203 (CN), 1643 (C=O), 1572 (C = C), 1373 and 1175 (SO 2 -N), 1240 (C=S), 746 cm -1 (C-Cl). 1 H NMR (DMSO-d 6 ) δ: 7.20-8.01 (m, 8H, Ar-H), 8.41 (s, 1H, indolyl 2-H), 10.15 (s, 1H, NH), 11.86 (s, 1H, NH). EI-MS: m/z (%) = 506/508 (M + /M + +2, 0.5/0.16). C 22 H 11 ClN 6 O 3 S 2 (506.94): calcd. C 52.12; H 2.19; N 16.58; found C 52.02; H 2.26; N 16.41.

Synthesis of compounds 7a-c and 8a-c

A mixture of compound 4a , 4b , or 4c (0.01 mol) and benzaldehyde or 4-nitro-benzaldehyde (0.01 mol) in absolute ethanol (20 ml) containing glacial acetic acid (0.2 ml) was heated under reflux for 6-10 h. After cooling, the reaction mixture was poured onto ice water (50 ml). The solid that formed was filtered off, washed with water, air dried, and crystallized from benzene.

7-(N-methanesulfonyl-1H-indol-3-yl)-5-oxo-2-phenyl-1, 2, 3, 5-tetrahydro [1, 2, 4] triazolo [1,5-a]pyridine-6,8-dicarbonitrile 7a ; melting point 214°C; yield 83%. IR (KBr): υ = 3286 and 3193 (NH), 2214 (CN), 1655 (C=O), 1523 (C=C), 1371 and 1172 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 3.91 (3H, s, SO 2 CH 3 ), 5.66 (1H, s, triazolyl 2-H), 6.99-8.37 (10H, m, Ar-H), 8.53 and 8.91 (2H, 2s, 2NH). EI-MS: m/z (%) = 456 (M + , 1.4). C 23 H 16 N 6 O 3 S (456.48): calcd. C 60.52; H 3.53; N 18.41; found C 60.35; H 3.41; N 18.27.

7-(N-benzenesulfonyl-1H-indol-3-yl)-5-oxo-2-phenyl-1, 2, 3, 5-tetrahydro [1, 2, 4] triazolo [1,5-a]pyridine-6,8-dicarbonitrile 7b ; melting point 160-162°C; yield 75%. IR (KBr): υ = 3338 (br. NH), 2212 (CN), 1672 (C=O), 1565 (C=C), 1364 and 1137 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 5.31 (s, 1H, triazolyl 2-H), 6.55-7.37 (m, 13H, Ar-H), 8.05 (d, 1H, indolyl 4-H), 8.40 (s, 1H, indolyl 2-H), 9.69 and 9.93 (2s, 2H, 2NH). C 28 H 18 N 6 O 3 S (518.55): calcd. C 64.85; H 3.50; N 16.21; found C 64.67; H 3.35; N 16.04.

7-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl)-5-oxo-2-phenyl-1, 2, 3, 5-tetrahydro [1, 2, 4]triazolo [1,5-a]pyridine-6, 8-dicarbonitrile 7c ; melting point 167-169°C; yield 78%. IR (KBr): υ = 3321 and 3164 (NH), 2205 (CN), 1675 (C=O), 1602 (C=C), 1353 and 1197 (SO 2 ), 743 cm -1 (C-Cl). 1 H NMR (DMSO-d 6 ) δ: 1.13 (s, 1H, NH), 5.54 (s, 1H, triazolyl 2-H), 7.07-8.04 (m, 13H, Ar-H), 8.22 (s, 1H, indolyl 2-H), 9.86 (s, H, NH). EI-MS: m/z (%) = 552/554 (M + /M + +2, 3.44/1.14). C 28 H 17 ClN 6 O 3 S (552.99): calcd. C 60.81; H 3.10; N 15.20; found C 60.66; H 2.93; N 15.01.

7-((N-methanesulfonyl)-1H-indol-3-yl)-2-(4-nitrophenyl)-5-oxo-1, 2, 3, 5-tetrahydro [1, 2, 4]triazolo [1,5-a]pyridine-6,8-dicarbonitrile 8a ; melting point 238-240°C; yield 85%. IR (KBr): υ = 3426 and 3316 (NH), 2203 (CN), 1676 (C=O), 1585 (C=C), 1359 and 1171 cm -1 (SO 2 -N). 1 H NMR (DMSO-d 6 ) δ: 4.19 (s, 3H, SO 2 CH 3 ), 5.66 (s, 1H, triazolyl 2-H), 7.23-8.09 (m, 9H, Ar-H) 9.58 and 10.04 (2s, 2H, 2NH). EI-MS: m/z (%) = 501 (M + , 3.38). C 23 H 15 N 7 O 5 S (501.47): calcd. C 55.09; H 3.01; N 19.55; found C 54.94; H 3.13; N 19.62.

7-((N-benzenesulfonyl)-1H-indol-3-yl)-2-(4-nitrophenyl)-5-oxo-1, 2, 3, 5-tetrahydro [1, 2, 4]triazolo [1,5-a]pyridine-6,8-dicarbonitrile 8b ; melting point 150-152°C; yield 88%. IR (KBr): υ = 3428 (br. NH), 2214 (CN), 1703 (C=O), 1638 (C=C), 1357 and 1183 cm -1 (SO 2 -N). 1 H NMR (DMSO-d 6 ) δ: 5.15 (s, 1H, triazolyl 2-H), 7.24-7.94 (13H, m, Ar-H), 8.35 (1H, d, indolyl H-2), 8.73 and 10.00 (2s, 2H, 2NH). EI-MS: m/z (%) = 563 (M + , 0.14). C 28 H 17 N 7 O 5 S (563.54): calcd. C 59.68; H 3.04; N 17.40; found C 59.51; H 3.11; N 17.26.

7-((N-(4-Chlorobenzenesulfonyl)-1H-indol-3-yl)-2-(4-nitrophenyl)-5-oxo-1, 2, 3, 5-tetrahydro [1, 2, 4]triazolo [1,5-a]pyridine-6,8-dicarbonitrile 8c ; melting point 157-159°C; yield 81%. IR (KBr): υ = 3316 and 3124 (NH), 2204 (CN), 1628 (C=O), 1583 (C=C), 1373 and 1182 (SO 2 -N), 755 cm -1 (C-Cl). 1 H NMR (DMSO-d 6 ) δ: 5.60 (s, 1H, triazolyl 2-H), 7.19-7.92 (m, 12H, Ar-H), 8.23 (s, 1H, indolyl 2-H), 9.88 (s, 1H, NH), 12.08 (s, 1H, NH). C 28 H 16 ClN 7 O 5 S (597.99): calcd. C 56.24; H 2.70; N 16.40; found C 56.12; H 2.57; N 16.26.

Synthesis of compounds 9a, 9b, and 9c

A mixture of compound 4a , 4b , or 4c (0.01 mol) and 1,2-dibromoethane (1.86 ml, 0.01 mol) in an ethanolic potassium hydroxide solution [ethanolic KOH 1 mol/l (20 ml)] was heated under reflux for 5-6 h. After cooling, the reaction mixture was poured onto ice water, and then the reaction mixture was filtered off. The filtrate was acidified with diluted hydrochloric acid (1 ml HCl: 1 ml H 2 O) and the solid that formed was filtered off, washed with water, air dried, and crystallized from dimethylformamide-water.

8-(N-methanesulfonyl-1H-indol-3-yl)-6-oxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 9a ; melting point 202°C; yield 91%. IR (KBr): υ = 3279 and 3160 (NH), 2219 (CN), 1717 (C=O), 1602 (C=C), 1384 and 1148 cm -1 (SO 2 -N). EI-MS: m/z (%) = 394 (M + , 0.83). C 18 H 14 N 6 O 3 S (394.41): calcd. C 54.81; H 3.58; N 21.31; found C 54.67; H 3.43; N 21.16.

8-(N-benzenesulfonyl-1H-indol-3-yl)-6-oxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 9b ; melting point 300°C; yield 83%. IR (KBr): υ = 3353 (br. NH), 2211 (CN), 1615 (C=O), 1553 (C=C), 1377 and 1128 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 3.25-3.01 (m, 4H, CH 2 -CH 2 ), 7.12-7.76 (m, 9H, Ar-H), 8.03 (s, 1H, indolyl 2-H), 8.52 (s, 1H, NH), 9.10 (s, 1H, NH). C 23 H 16 N 6 O 3 S (456.48): calcd. C 60.52; H 3.53; N 18.41; found C 60.45; H 3.40; N 18.32.

8-[N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl]-6-oxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 9c ; melting point 158-160°C; yield 86%. IR (KBr): υ = 3369 (NH), 2195 (CN), 1639 (C=O), 1563 (C=C), 1370 and 1175 (SO 2 -N), 746 cm -1 (C-Cl). 1 H NMR (DMSO-d6) δ: 1.34 and 1.52 (2s, 2H, 2NH), 2.84 (m, 4H, 2CH 2 ), 7.16-8.52 (m, 9H, Ar-H). EI-MS: m/z (%) = 490/492 (M + , 6.35/2.11). C 23 H 15 ClN 6 O 3 S (490.92): calcd. C 56.27; H 3.08; N 17.12; found C 56.12; H 3.14; N 17.04.

Synthesis of compounds 10a, 10b, and 10c

A solution of compound 4a , 4b , or 4c (0.01 mol), chloroacetyl chloride (1.13 ml, 0.01 mol), and triethylamine (0.59 ml, 0.01 mol) in dry 1,4-dioxane (10 ml) was heated under reflux for 15-16 h. The reaction mixture was filtered off while hot and the solvent was removed under vacuum. The residue was triturated with water, filtered off, air dried, and crystallized from absolute ethanol.

8-(N-methanesulfonyl-1H-indol-3-yl)-2,6-dioxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 10a ; melting point 97-99°C; yield 88%. IR (KBr): υ = 3280 (NH), 2207 and 2218 (CN), 1712 (C=O), 1567 (C=C), 1348 and 1147 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 2.18 (s, 1H, NH), 3.73 (s, 3H, SO 2 CH 3 ), 4.32 (s, 2H, CH 2 ), 7.13-7.65 (m, 4H, Ar-H), 8.26 (s, 1H, indolyl 2-H), 11.88 (s, 1H, NH). EI-MS: m/z (%) = 408 (M + , 1.15). C 18 H 12 N 6 O 4 S (408.39): calcd. C 52.94; H 2.96; N 20.58; found C 52.79; H 2.81; N 20.43.

8-(N-benzenesulfonyl-1H-indol-3-yl)-2,6-dioxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 10b ; melting point 135-137°C; yield 94%. IR (KBr): υ = 3378 and 3164 (NH), 2215 (CN), 1707 (C=O), 1566 (C=C), 1355 and 1144 cm -1 (SO 2 -N). EI-MS: m/z (%) = 470 (M + , 0.68). C 23 H 14 N 6 O 4 S (470.46): calcd. C 58.72; H 3.00; N 17.86; found C 58.57; H 2.91; N 17.72.

8-[N-(4-chlorobenzenesulfonyl)-1H-indol-3-yl]-2,6-dioxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 10c ; melting point 88-90°C; yield 79%. IR (KBr): υ = 3278 and 3176 (NH), 2216 (CN), 1705 and 1699 (C=O), 1565 (C=C), 1386 and 1146 (SO 2 -N), 737 cm -1 (C-Cl). 1 H NMR (DMSO-d 6 ) δ: 5.46 (s, 2H, CH 2 ), 5.52 (s, 1H, NH), 7.19-7.75 (m, 8H, Ar-H), 8.15 (s, 1H, indolyl 2-H), 8.91 (s, 1H, NH). C 23 H 13 ClN 6 O 4 S (504.91): calcd. C 54.71; H 2.60; N 16.64; found C 54.56; H 2.45; N 16.49.

Synthesis of compounds 11a, 11b, and 11c

To a solution of compound 2a, 2b, or 2c (0.01 mol) in dry ethanol (10 ml) containing triethylamine (0.5 ml), hydrazine hydrate 99% (1 ml, 0.02 mol) was added. The reaction mixture was heated under reflux for 6-8 h. After cooling, the reaction mixture was poured onto ice water (50 ml), and the solid that formed was filtered off, air dried, and crystallized from absolute ethanol.

4-(N-methanesulfonyl-1H-indol-3-ylmethylene)-4H-pyrazole-3,5-diamine 11a ; melting point 272°C; yield 86%. IR (KBr): υ = 3435 and 3264 (NH 2 ), 1618 (C=N), 1585 (C=C), 1384 and 1180 cm -1 (SO 2 -N). EI-MS: m/z (%) = 303 (M + , 0.28). C 13 H 13 N 5 O 2 S (303.34): calcd. C 51.47; H 4.32; N 23.09; found C 51.32; H 4.17; N 22.97.

4-(N-benzenesulfonyl-1H-indol-3-ylmethylene)-4H-pyrazole-3,5-diamine 11b ; melting point 134-136°C; yield 81%. IR (KBr): υ = 3391 and 3254 (NH 2 ), 1618 (C=N), 1521 (C=C), 1380 and 1171 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 3.81 (s, 2H, NH 2 ), 5.46 (s, 2H, NH 2 ), 5.52 (s, 1H, CH=C), 7.19-7.81 (m, 9H, Ar-H), 8.33 (s, 1H, indolyl 2-H). EI-MS: m/z (%) = 365 (M + , 0.19). C 18 H 15 N 5 O 2 S (365.41): calcd. C 59.16; H 4.14; N 19.17; found C 59.04; H 4.02; N 19.06.

4-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-ylmethylene)-4H-pyrazole-3,5-diamine 11c ; melting point 54-56°C; yield 73%. IR (KBr): υ = 3444 and 3265 (NH 2 ), 1588 (C=N), 1529 (C=C), 1348 and 1178 (SO 2 -N), 743 cm -1 (C-Cl). EI-MS: m/z (%) = 399/401 (M + /M + +2, 0.01/0.003). C 18 H 14 ClN 5 O 2 S (399.85): calcd. C 54.07; H 3.53; N 17.51; found C 53.95; H 3.37; N 17.38.

Synthesis of compounds 12a, 12b, and 12c

In a mixture of compound 2a, 2b, or 2c (0.01 mol), phenylhydrazine (1.08 ml, 0.01 mol) in dry ethanol (10 ml) containing triethylamine (0.5 ml) was heated under reflux for 6-8 h. After cooling, the solid that formed was filtered off, air dried, and crystallized from absolute ethanol.

4-((N-methanesulfonyl)-1H-indol-3-ylmethylene)-5-imino-1-phenyl-4,5-dihydro-1H-pyrazol-3-ylamine 12a ; melting point 130-132°C; yield 77%. IR (KBr): = 3414 (NH 2 ), 3146 (NH), 1640 (C=N), 1574 (C=C), 1396 and 1150 cm -1 (SO 2 -N). EI-MS: m/z (%) = 379 (M + , 0.08). C 19 H 17 N 5 O 2 S (379.44): calcd. C 60.14; H 4.52; N 18.46; found C 60.03; H 4.38; N 18.34.

4-((N-benzenesulfonyl)-1H-indol-3-ylmethylene)-5-imino-1-phenyl-4,5-dihydro-1H-pyrazol-3-ylamine 12b ; melting point 166-168°C; yield 87%. IR (KBr): υ = 3427 (NH 2 ), 3127 (NH), 1635 (C=N), 1609 (C=C), 1384 and 1163 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 5.47 (s, 1H, CH=C), 5.72 (s, 1H, NH), 7.15-8.14 (m, 14H, Ar-H), 8.38 (s, 1H, indolyl 2-H), 8.52 (s, 2H, NH 2 ). EI-MS: m/z (%) = 441 (M + , 12.76). C 24 H 19 N 5 O 2 S (441.50): calcd. C 65.29; H 4.34; N 15.86; found C 65.16; H 4.18; N 15.74.

4-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-ylmethylene)-5-imino-1-phenyl-4,5-dihydro-1H-pyrazol-3-ylamine 12c ;melting point 158-160°C; yield 81%. IR (KBr): υ = 3450 (NH 2 ), 3210 (NH), 1639 (C=N), 1575 (C=C), 1383 and 1179 (SO 2 -N), 756 cm -1 (C-Cl). EI-MS: m/z (%) = 475/477 (M + /M + +2, 0.01/0.003). C 24 H 18 ClN 5 O 2 S (475.95): calcd. C 60.56; H 3.81; N 14.71; found C 60.41; H 3.66; N 14.56.

Synthesis of compounds 13a-c and 14a-c

A mixture of compound 2a , 2b , or 2c (0.01 mol) and urea or thiourea (0.01 mol) in dry ethanol (10 ml) containing triethylamine (0.5 ml) was heated under reflux for 8-10 h. After cooling, the reaction mixture was poured onto ice water (50 ml) and the solid that formed was filtered off, air dried, and crystallized from absolute ethanol to yield 13a-c or 14a-c , respectively.

4,6-diamino-5-(N-methanesulfonyl-1H-indol-3-ylmethylene)-5H-pyrimidin-2-one 13a ; melting point 114-116°C; yield 77%. IR (KBr): υ = 3212 and 3172 (NH 2 ), 1706 (C=O), 1644 (C=N), 1584 (C=C), 1387 and 1139 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 3.73 (s, 3H, SO 2 CH 3 ), 5.57 (s, 1H, CH=C), 7.06-7.48 (m, 4H, Ar-H), 8.13 (s, 1H, indolyl 2-H), 9.90 (s, 2H, NH 2 ), 12.11 (s, 2H, NH 2 ). EI-MS: m/z (%) = 331(M + , 0.25). C 14 H 13 N 5 O 3 S (331.35): calcd. C 50.75; H 3.95; N 21.14; found C 50.59; H 3.77; N 21.05.

4,6-diamino-5-((N-benzenesulfonyl)-1H-indol-3-ylmethylene)-5H-pyrimidin-2-one 13b ; m.p. 110-112°C; yield 71%. IR (KBr): υ = 3450 and 3272 (NH 2 ), 1703 (C=O), 1639 (C=N), 1575 (C=C), 1383 and 1179 cm -1 (SO 2 -N). EI-MS: m/z (%) = 393 (M + , 0.02). C 19 H 15 N 5 O 3 S (393.42): calcd. C 58.01; H 3.84; N 17.80; found C 58.12; H 3.71; N 17.64.

4,6-diamino-5-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-ylmethylene)-5H-pyrimidin-2-one 13c ; melting point 150-152°C; yield 69%. IR (KBr): υ = 3427 and 3228 (NH 2 ), 1712 (C=O), 1634 (C=N), 1609 (C=C), 1384 and 1163 (SO 2 -N), 744 cm -1 (C-Cl). 1 H NMR (DMSO-d6) δ: 2.04 (s, 2H, NH 2 ), 2.47 (s, 2H, NH 2 ), 5.57 (s, 1H, CH=C), 7.17-7.78 (m, 9H, Ar-H), 8.15 (s, 1H, indolyl 2-H). C 19 H 14 ClN 5 O 3 S (427.86): calcd. C 53.34; H 3.30; N 16.37; found C 53.17; H 3.21; N 16.23.

4,6-diamino-5-(N-(4-methanesulfonyl)-1H-indol-3-ylmethylene)-5H-pyrimidine -2-thione 14a ; melting point 125-127°C; yield 67%. IR (KBr): υ = 3401 and 3212 (NH 2 ), 1623 (C=N), 1526 (C=C), 1379 and 1130 (SO 2 -N), 1244 cm -1 (C=S). 1 H NMR (DMSO-d6) δ: 2.46 (s, 2H, NH 2 ), 4.14 (s, 3H, SO 2 CH 3 ), 5.23 (s, 2H, NH 2 ), 5.71 (s, 1H, CH=C), 7.07-7.76 (m, 4H, Ar-H), 8.18 (s, 1H, indolyl 2-H). EI-MS: m/z (%) = 347 (M + , 0.02). C 14 H 13 N 5 O 2 S 2 (347.42): calcd. C 48.40; H 3.77; N 20.16; found C 48.25; H 3.63; N 20.03.

4,6-diamino-5-(N-benzenesulfonyl-1H-indol-3-ylmethylene)-5H-pyrimidine-2-thione 14b ; melting point 130-132°C; yield 65%. IR (KBr): υ = 3396 and 3255 (NH 2 ), 1618 (C=N), 1523 (C=C), 1386 and 1175 (SO 2 ), 1240 cm -1 (C=S). EI-MS: m/z (%) = 409 (M + , 55.55). C 19 H 15 N 5 O 2 S 2 (409.48): calcd. C 55.73; H 3.69; N 17.10; found C 55.55; H 3.54; N 17.02.

4,6-diamino-5-(N-(4-chlorobenzenesulfonyl)-1H-indol-3-ylmethylene)-5H-pyrimidine-2-thione 14c ; melting point 109-111°C; yield 62%. IR (KBr): υ = 3400 and 3228 (NH 2 ), 1618 (C=N), 1590 (C=C), 1383 and 1179 (SO 2 -N), 1243 (C=S), 755 cm -1 (C-Cl). EI-MS: m/z (%) = 443/445 (M + /M + +2, 7/2). C 19 H 14 ClN 5 O 2 S 2 (443.93): calcd. C 51.41; H 3.18; N 15.78; found C 51.29; H 3.04; N 15.66.

Synthesis of compounds 15a, 15b, and 15c

A mixture of compound 2a , 2b , or 2c (0.01 mol), guanidine hydrochloride (0.96 g, 0.01 mol), and triethylamine (1 ml) in dry ethanol (15 ml) was heated under reflux for 2-3 h. After cooling, the solid that formed was filtered off, air dried, and crystallized from absolute ethanol.

2-imino-5-(N-methanesulfonyl-1H-indol-3-ylmethylene)-2,5-dihydro-pyrimidine-4,6-diamine 15a ; m.p. 98-100°C; yield 66%. IR (KBr): υ = 3403 and 3249 (NH 2 ), 3173 (NH), 1634 (C=N), 1526 (C=C), 1385 and 1180 cm -1 (SO 2 -N). EI-MS: m/z (%) = 330 (M + , 1.11). C 14 H 14 N 6 O 2 S (330.36): calcd. C 50.90; H 4.27 N 25.44; found C 50.78; H 4.14; N 25.32.

2-Imino-5-(N-benzenesulfonyl-1H-indol-3-ylmethylene)-2,5-dihydropyrimidine-4,6-diamine 15b ; melting point 140-142°C; yield 61%. IR (KBr): υ = 3443, 3378 and 3273 (NH 2 ), 3121 (NH), 1624 (C=N), 1569 (C=C), 1350 and 1176 cm -1 (SO 2 -N). 1 H NMR (DMSO-d6) δ: 1.60 (s, 2H, NH 2 ), 2.98 (s, 2H, NH 2 ), 5.46 (s, 1H, CH=C), 6.52 (s, 1H, NH), 7.16-7.82 (m, 9H, Ar-H), 8.21 (s, 1H, indolyl 2-H). EI-MS: m/z (%) = 392 (M + , 0.08). C 19 H 16 N 6 O 2 S (392.43): calcd. C 58.15; H 4.11; N 21.42; found C 58.07; H 4.01; N 21.35.

2-imino-5-(N-(4-chlorobenzenesulfonyl-1H-indol-3-ylmethylene)-2,5-dihydropyrimidine-4,6-diamine 15c ; melting point 90-92°C; yield 54%. IR (KBr): υ = 3428 and 3327 (NH 2 ) 3195 (NH), 1624 (C=N), 1554 (C=C), 1336 and 1150 (SO 2 -N), 751 cm -1 (C-Cl). 1 H NMR (DMSO-d6) δ: 1.87 (s, 2H, NH 2 ), 5.47 (s, 1H, CH=C), 5.72 (s, 1H, NH), 7.15-7.82 (m, 8H, Ar-H), 8.18 (s, 1H, indolyl 2-H), 8.52 (s, 2H, NH 2 ). C 19 H 15 ClN 6 O 2 S (426.88): calcd. C 53.46; H 3.54; N 19.69; found C 53.31; H 3.38; N 19.52.


  Biological assay Top


Cell propagation and maintenance

Hepatocellular carcinoma HepG2 cells were purchased from the holding company for biological products and vaccines (VACSERA, Agouza, Giza, Egypt) and maintained under the proper conditions. The cells were cultured in Dulbecco's modified Eagle's medium (Sigma-Aldrich, St Louis, Missouri, USA) supplemented with 100 IU/ml penicillin G sodium, 100 lU/ml streptomycin sulfate, 1% l-glutamine, and 10% fetal bovine serum at 37°C in a humidified incubator with 5% CO 2 . The cells were harvested after trypsinization (0.025% trypsin and 0.02% EDTA) and washed twice with Dulbecco's PBS (Bio-Whittaker, Lonza, Verviers, Belgium). When the cell density reached ∼80%, cells were split for further culture. The experiments were conducted when the cells were in the logarithmic growth phase.

Cytotoxicity assay

Cell viability was measured using a neutral red uptake assay [26]. The neutral red uptake assay provides a quantitative estimation of the number of viable cells in a culture. It is based on the ability of viable cells to incorporate and bind the supravital dye neutral red in the lysosomes. The cells were incubated with various concentrations of the test compounds (25, 125, 250, 500, and 1000 μmol/l) for 48 h at a cell density of 10 4 cells/well of a 96-well plate. A neutral red working solution (0.4 μg/ml) (Sigma-Aldrich) was incubated overnight at 37°C in the same manner as the treated cells.

In each well of the incubated cells, culture media were removed and neutral red medium (100 μl) was added, and then incubated for 2 h to allow for vital dye incorporation into living cells. The neutral red media were removed and rinsed rapidly with Dulbecco's PBS buffer (150 μl). Dye was extracted from the cells by adding extraction buffer [150 μl, 1% acetic acid : 50% ethanol (96%): 49% deionized H 2 O], followed by rapid agitation for at least 10 min on a micrometer plate shaker. The extract neutral red color intensity was measured at 530 and 645 nm as excitation and emission wavelengths in a micro-titer plate reader spectrophotometer (Sorin, Biomedica S.p.A., Milan, Italy). Using the relation between the concentrations used and the neutral red intensity value, the IC 50 of the tested compounds was calculated. For the untreated cells (negative control), medium was added instead of the test compounds. A positive control Adrinamycin (doxorubicin) (Mr = 579.9) was used as a cytotoxic natural agent yielding 100% inhibition. DMSO was the vehicle used for dissolution of the tested compound and its final concentration on the cells was less than 0.2%. All tests and analyses were carried out in triplicate and the results were averaged.

Gene expression analysis

HepG2 cells were seeded (4 × 10 4 cells/well) and incubated with different treatments at 37°C for 48 h. The total RNA was isolated using PeqGold Trifast (Biotechnologie GmbH, Erwin-Rentschler-Strasse 21 Laupheim, 88471, German) according to the manufacturer's instructions. The primer sequence for Beta-actin gene is as follows: forward, CCTTCCTGGGCATGGAGTCCT; reverse, GGAGCAATGATCTTGA TCTTC. Primer sequence for BCL-2 gene is: forward, CCTGGTGGACAACATCGCC; reverse, AATCAAACAGAGGCCG CATGC. Qiagen on step RT PCR kit (Qiagen Inc., Valencia, California, USA) was used for RNA reverse transcription and subsequent amplification. PCR reaction was performed separately for Beta-actin and BCl-2 by adding 2 μg RNA to the PCR mixture and making the reaction volume up to 50 μl. The PCR mixture included 2 mmol/l Tris-HCl, 10 mmol/l KCl, NH 2 SO 4 , 1.25 m,ol/l MgCl 2 , and 0.1 mmol/l dithiothreitol, pH 8.7, 0.4 mmol/l dNTPs mixture, Qiagen one step RT PCR enzyme, Mix (Omniscript TM reverse transcriptase, Sensiscript TM reverse transcriptase and Hot star TaqR DNA polymerase), and 0.6 μmol/l of each specific primer. The reaction mixture was subjected to reverse transcription at 50°C for 30 min and then to 35 cycles of PCR amplification (BioRad-T100 thermal cycler; BioRad, Hercules, California, USA) as follows: denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min. The PCR products were separated on a 1.5% agarose gel and visualized using a gel documentation system. The genes' expressions were semiquantified using LabImage analysis (Labmage version 2.7.0, Kapelan Bio-Imagin GmbH, Leipzig, Germany) software.

Statistical analysis

Data were analyzed using version 13 of a computer-based statistical package (SPSS Inc., Chicago, IL, USA). Results are expressed as means ± SD of three independent experiments. Statistical significance of difference was determined using analysis of variance (one-way analysis of variance). Further statistical analysis for post hoc comparisons was carried out using the LSD test. A level of P more than 0.05 was considered to be statistically significant.

Molecular docking studies

Docking studies of the most proapoptotic active compounds were carried out using the Molecular Operating Environment (MOE) 2008.10 release of Chemical Computing Group (Montereal, Canada; http://www.chemcomp.com). The program operated on an Intel core i3-32100 CPU@3.10 GHz 3.09 GHz processor, 3.41 GB of RAM, Microsoft Windows XP (Microsoft Corporation, 1 Microsoft Way, Redmond, WA, 98052, United States). The protein crystal structure of CHIMAERIC BCL2-XL in complex with 1-(2-{[(3S)-3-(aminomethyl)-3,4-dihydroisoquinolin-2(1H)-yl]carbonyl}phenyl)-4-chloro-5-methyl-N,N-diphenyl-1H-pyrazole-3-carboxamide was downloaded from http://www.rcsb.org/pdb (PDB ID: 2W3L) as selective BCL-2 inhibitors [27].

The protein crystal structure was prepared for docking by removing water molecules, adding and removing polar hydrogen atoms, and then isolating the active pocket. The active pocket was considered to be the site where the cocrystalline ligand, namely, tetrahydroisoquinoline amide complexes with the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L). The active pocket consisted of 12 amino acid residues such as Leu96, Ala108, Phe112, Phe63, Tyr67, Met74, Phe71, Asp70, Val92, Glu95, Arg108, and Gly104.

The cocrystalline ligand was redocked in the active pocket to insure that the docking method was efficient, and the active pocket was saved as a MOE file to be used for docking simulation of the selected compounds (ligands).

The structures of the selected compounds (ligands) for docking were drawn in ChemDraw Ultra 10.0 (Cheminformatics Software company based in Cambridge, Massachusetts, USA) and saved as mol. Before the docking, preparation steps had to be taken as follows:

(a) Conversion of the 2D structure of ligands into their 3D form;

(b) Addition and removal of polar hydrogen atoms;

(c) Energy minimization using the MMFF94x forcefield until a root-mean-square deviation of the atomic position gradient of 0.01 kcal/mol/Ε was reached and then it was saved as moe.

MMFF94x was reported as the efficient force field for minimization of ligand-protein complexes [28].

The docking algorithm was performed by MOE-DOCK default. It uses a flexible rigid technique to place the molecule within the cavity. All rotatable bonds of ligands are allowed to undergo free rotation for placement in a rigid receptor-binding site.

The docking scores were expressed in negative energy terms; the lower the binding free energy, the better the binding affinity [29].


  Results and discussion Top


Chemistry

The synthetic routes of the target compounds are outlined in Schemes 1-3. The starting 2-(N-substituted sulfonyl-1H-indol-3-yl)methylene)malononitriles 2a-c was prepared by a base-catalyzed reaction of N-methyl, N-phenyl and N-(p-chlorobenzene)sulfonyl-3-indolyl carboxaldehydes ( 1a-c ) with malononitrile in absolute ethanol under stirring at room temperature (Scheme 1 [Additional file 1]). Compound 2b has been reported previously [25], whereas compounds 2a and 2c are new and their structure were confirmed on the basis of their correct elemental analyses, and IR and 1 H NMR spectra. IR spectra of 2a and 2c showed characteristic absorption bands at 2207 and 2195 cm -1 because of the CN group. Their 1 H NMR showed singlet signals at δ 7.84 and 7.62 ppm because of CH=C protons.

Cyclocondensation of 2a-c with 2'-acetyl-2-cyanoacetohydrazide in absolute ethanol containing triethylamine as a catalyst led to the formation of fused 7-(N-substituted sulfonyl-1H-indol-3-yl)-2-methyl-5-oxo-3,5-dihydro- [1, 2, 4]triazolo [1,5-a]pyridine-6,8-dicarbonitriles 3a-c (Scheme 1). IR spectra of each 3a, 3b , and 3c showed additional absorption bands at ∼1703-1730 cm -1 characteristic of the C=O group. 1 H NMR of 3a and 3c lack the presence of CH=C and showed new singlet signals at δ 2.17 and 1.19 ppm, respectively, for (3H, CH 3 ), in addition to D 2 O exchangeable singlet signals at δ 8.12 and 8.78 ppm, respectively, for NH protons.

However, the reaction of compounds 2a-c with 2-cyanoacetic acid hydrazide in refluxing ethanolic piperidine yielded the corresponding 1,6-diamino-4-(N-substituted sulfonyl-1H-indol-3-yl)-2-oxo-1,2-dihydropyridine-3,5-dicarbonitriles 4a-c (Scheme 1). 1 H NMR spectra of 4a-c showed D 2 O exchangeable singlet signals at δ∼1.14-2.96 and 2.98-12.11 ppm because of C-NH 2 and N-NH 2 protons, respectively.

Acetylation of 1,6-diaminopyridines 4a-c using acetic anhydride led to the formation of the corresponding diacetamides, namely, N-(6-acetylamino-3,5-dicyano-4-(N-substituted sulfonyl-1H-indol-3-yl)-2-oxo-2H-pyridin-1-yl)acetamides 5a-c (Scheme 2 [Additional file 2]).

Moreover, compounds 4a-c were used as starting materials for build-up of the fused heterocyclic system through a ring closure reaction of their α, β-bifunctional amino groups. Cyclization of 4a-c with excess carbon disulfide in an ethanolic potassium hydroxide solution yielded the fused 7 -(N-substituted sulfonyl-1H-indol-3-yl)-5-oxo-2-thioxo-1, 2, 3, 5-tetrahydro [1, 2, 4]triazolo [1,5-α]pyridine-6,8-dicarbonitriles 6a-c (Scheme 2).

Furthermore, the reaction of compounds 4a-c with aromatic aldehydes, namely, benzaldehyde and/or 4-nitrobenzaldehyde under reflux in absolute ethanol containing a catalytic amount of glacial acetic acid yielded the fused triazolo [1,5-α]pyridine derivatives 7a-c and 8a-c (Scheme 2). 1 H NMR spectra of each 7a-c and 8a-c showed singlet signals at δ 5.66, 5.31, 5.54, 5.66, 5.15, and 5.60 ppm, respectively, attributable to (1H, triazolyl 2-H), in addition to D 2 O exchangeable singlet signals at δ ∼1.13-12.08 ppm because of NH protons besides the aromatic protons.

However, the reaction of compounds 4a-c with 1,2-dibromoethane under reflux in an ethanolic potassium hydroxide solution yielded 8-(N-substituted sulfonyl-1H-indol-3-yl)-6-oxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitrile 9a-c (Scheme 2). Reaction of compounds 4a-c with choloroacetyl chloride under reflux in dry 1,4-dioxane yielded 8-(N-substituted sulfonyl-1H-indol-3-yl)-2,6-dioxo-1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine-7,9-dicarbonitriles 10a-c (Scheme 2).

Various arylidene malononitriles have been used as intermediates for the synthesis of pyrazole, pyrimidine, and pyridine derivatives [30]. In the present study, the reaction of compounds 2a-c with hydrazine hydrate and phenyl hydrazine in dry ethanol containing a catalytic amount of triethylamine led to the formation of the new pyrazole derivatives 11a-c and 12a-c (Scheme 3 [Additional file 3]). The reaction of compounds 2a-c with urea and/or thiourea in dry ethanol containing triethylamine yielded the corresponding pyrimidin-2-ones 13a-c and pyrimidine-2-thiones 14a-c , respectively (Scheme 3).

Finally, cyclization of compounds 2a-c with guanidine hydrochloride under reflux in dry ethanol containing triethylamine yielded 2-imino-5-(N-substituted sulfonyl-1H-indol-3-ylmethylene)-2,5-dihydropyrimidine-4,6-diamines 15a-c (Scheme 3).


  Biological assay Top


Cytotoxic activity

The newly synthesized compounds were investigated individually as anticancer agents against the human hepatocellular carcinoma cell line (HepG2) at concentrations of 25, 125, 250, 500, and 1000 mmol/l. The inhibition of proliferation of the HepG2 cell line was determined using a neutral red assay, which is based on the ability of viable cells to incorporate and bind the supravital dye neutral red in the lysosomes. Doxorubicin was used as a reference drug (IC 50 , 3.4 μmol/l). The use of DMSO as a solvent had an insignificant effect on the viability of HepG2 cells when treated for 48 h. From the data obtained [Table 1], [Figure 1],[Figure 2] and [Figure 3], the most active compounds against the HepG2 cancer cell line were in the descending order of 10b>4c>10a>10c . The existence of 1, 3, 4, 6-tetrahydro-2H-pyrido [1,2-b] [1, 2, 4]triazine at position-3 of indole as in compounds 10a , 10b ,and 10c showed growth inhibition with IC 50 values of 35, 24, and 40 μmol/l, respectively, compared with the control cell. However, the existence of chlorine atom at the para position of the benzenesulfonyl moiety at the N-position of indole with 1,6-diamino-1,2-dihydropyridine at position-3 of indole as in 4c showed growth inhibition with an IC 50 of 30 μmol/l.
Figure 1: Effects of test compounds 3a, 3c, 4a, 4b and 4c on HepG2 cell line at 48 h incubation time.

Click here to view
Figure 2: Effects of test compounds 5c, 6c, 7c, 9b, and 9c on the HepG2 cell line at 48 h incubation time.

Click here to view
Figure 3: Effects of test compounds 10a, 10b, 10c, 12a, 13c, 1 5a, and 15c on the HepG2 cell line at 48 h incubation time.

Click here to view
Table 1: In-vitro cytotoxic activity of the newly synthesized compounds on the HepG2 cancer cell line

Click here to view


Furthermore, compounds 3c , 6c , 9c , 4b , and 5c showed moderate to slight growth inhibition with IC 50 values of 110,120, 147, 150, and 180 mmol/l, respectively [Table 1], [Figure 1],[Figure 2] and [Figure 3]. However, the rest of the compounds showed no activity against the HepG2 cancer cell line compared with control cells [Table 1]. The activities of compounds 3c , 6c , 9c , and 5c seem to be related to the presence of chlorine atoms at the para position of the benzenesulfonyl moiety.

BCL -2 gene expression patterns

The BCL-2 gene binds to the outer mitochondrial membrane and increases cell survival by acting as an anti-apoptotic factor, rather than by promoting cell proliferation. It has also been identified as an oncogene that prevents apoptosis in tumor cells [2]. There are a number of theories on how the Bcl-2 gene family exerts its proapoptotic or anti-apoptotic effect. An important one states that this is achieved by activation or inactivation of an inner mitochondrial permeability transition pore, which is involved in the regulation of matrix Ca ++ , pH, and voltage. It is also believed that some Bcl-2 family proteins can induce (proapoptotic members) or inhibit (anti-apoptotic members) the release of cytochrome c into the cytosol, which, once there, activates caspase-9 and caspase-3, leading to apoptosis. Strong evidence suggests an earlier implication of the mitochondrial apoptosis-induced channel pore on the outer membrane [31],[32]. On the basis of these findings, we investigated the effect of the proposed treatments on BCL-2 gene expression.

The newly synthesized compounds 3c , 4b , 4c , 5c , 6c , 9c , 10a , 10b , and 10c , which showed IC 50 values ranging from 24 to 180 μmol/l, were chosen to study their proapoptotic effects. BCL-2 gene expression levels were determined by calculation of the ratio of its expression level to that of β-actin by a semi-quantitative analysis. The result showed that compounds 4c , 5c , 9c , 10a , 10b , and 10c significantly inhibited the expression levels of the BCL-2 gene [Figure 4]. Our finding is similar to that of Lin et al. [33], who reported that novel 6-acetyl-9-(3, 4, 5-trimetho-xybenzyl)-9H-pyrido [2,3-b]indole induces mitotic arrest and apoptosis in human COLO 205 cells. This anticancer effect was attributed to the ability of the indole derivative to disrupt microtubule assembly and induce G2/M arrest, polyploidy, and apoptosis by mitochondrial pathways in COLO 205 cells. In addition, it reduced the levels of procaspase-3, procaspase-9, BCL-xL, and BCL-2 gene [33].
Figure 4: (a) RT– PCR product of the BCL-2 gene and b-actin genes expressed in the hepatocellular carcinoma cell line (HepG2). Lane 1 represents the DNA marker; lanes 2– 9 represent compounds 4b, 4c, 5c, 9c, 10a, 10b, 10c, and control, respectively. (b) Expression of the BCL-2 gene in the hepatocellular carcinoma cell line (HepG2). The gene expression was estimated as the ratio between the intensity of the BCL-2 gene and the ¦Â-actin gene. Data are expressed as mean ± SE. 'a' represents a signifi cant difference compared with the control (P < 0.05).

Click here to view


Molecular docking studies

The result of the proapoptotic effects of the tested compounds led us to carry out molecular docking studies to understand the ligand-protein interactions in detail. Compounds 4b , 4c , 5c , 9c , 10a , 10b , and 10c were docked against the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L) using MOE 2008.10 program. From the data obtained [Table 2], [Figure 5],[Figure 6] and [Figure 7], it was found that compounds 5c and 9c show good fitting inside the pockets site of the protein molecular surface and had a minimum binding energy of -20.29 and -18.98 kJ/mol, respectively, in comparison with the cocrystallized ligand 1-(2-{[(3S)-3-(aminomethyl)-3,4-dihydro-isoquinolin-2(1H)yl]carbonyl}phenyl)-4-chloro-5-methyl-N,N-diphenyl-1H-pyrazole-3-carboxamide, which has a binding energy of −16.28 kJ/mol, an root-mean-square deviation value of 1.95, and formed only one hydrogen bond at distance 2.30 Ε [Table 2], [Figure 5]a and b.
Figure 5: (a) Docked conformation alignment of cocrystallized ligand (tetrahydroisoquinoline amide) in the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L)-binding site. (b) Simplifi ed structure showing an interaction between tetrahydroisoquinoline amide and the amino acid residues in the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L)
active site.


Click here to view
Figure 6: (a) Docked conformation alignment of 5c and its original cocrystallized ligand in the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L)-binding site. (b) Simplified structure showing an interaction between 5c and the amino acid residues in the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L) active site.

Click here to view
Figure 7: (a) Docked conformation alignment of 9c and its original cocrystallized ligand in the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L)-binding site. (b) Simplifi ed structure showing an interaction between 9c and the amino acid residues in the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L) active site.

Click here to view


Compound 5c , in which N,N'-diacetamido-2-oxopyridine incorporated into an indole ring, forms an H-bond with the amino acid residues of the pocket site, C=O of the acetamido group, with a C=O of Tyr67 at a distance of 2.76 Ε [Figure 6]a and b. This compound has the best docking score with a minimum binding energy of (−20.29 kJ/mol), which correlates with the result of the pro-apoptotic effect.
Table 2: Docking results of the most active compounds that docked with the CHIMAERIC BCL2-XL protein (PDB ID: 2W3L)

Click here to view


Replacement of the acetamido group by the triazine moiety as in compound 9c maintained the good fit within the pocket site of the protein molecular surface, with one H-bond formed between C=O of pyridine and NH of Arg105 at a distance of 2.56 Ε, in addition to an arene-arene link between the phenyl ring of indole and the phenyl ring of Tyr67 [Figure 7]a and b, but with a binding energy of (−18.98 kJ/mol) higher than the cocrystal ligand and less than compound 5c .

We can conclude that biological results were supported by docking results, which suggested that compounds 5c and 9c significantly inhibited the expression levels of the BCL-2 gene by a likeness approach that has 2W3L inhibitory activity.


  Conclusion Top


A new series of triazolopyridines 3a-c, diaminopyridines 4a-c , pyridine diacetamides 5a-c , triazolo [1,5-a]pyridines 6a-c-8a-c , pyrido [1,2-b] [1, 2, 4] triazines 9a-c, 10a-c , pyrazoles 11a-c , 12a-c , and pyrimidine 13a-c-15a-c derivatives incorporated into N-substituted sulfonyl indoles at their 3-positions were prepared. The newly synthesized compounds were tested for their in-vitro cytotoxic activity against the HepG2 cell line. Compounds 3c , 4b , 4c , 5c , 6c , 9c , 10a , 10b , and 10c , which showed promising IC 50 values, were chosen for the study of their pro-apoptotic effects. Compounds 4c , 5c , 9c , 10a , 10b , and 10c significantly inhibited the expression levels of the BCL-2 gene. The binding mode of the most promising proapoptotic compounds was carried out by docking with CHIMAERIC BCL2-XL protein (PDB ID: 2W3L). The results indicated that compounds 5c and 9c showed a good fit within the pocket site of the protein molecular surface and had a minimum binding energy of −20.29 and −18.98 kJ/mol, respectively, in comparison with the cocrystallized ligand, which is in agreement with the experimental result of a pro-apoptotic effect.

Therefore, they might be considered good inhibitors of CHIMAERIC BCL2-XL protein and consequently have a high proapoptotic activity.


  Acknowledgements Top


The authors are grateful to the Micro-analytical Unit, National Research Centre, Giza, Egypt, for carrying out elemental analyses and determination of spectral data.

Conflicts of interest

None declared.

 
  References Top

1.
Tsujimoto Y, Cossman E, Croce C. Involvement of the BCL-2 gene in human follicular lymphomas. Science 1985; 228:1440.  Back to cited text no. 1
    
2.
Handayani T, Sakinah S, Nallappan M, Pihie AH. Regulation of p53, BCL-2 and caspase dependent signaling pathway in xanthorrhizol-induced apoptosis of HepG2 hepatoma cells. Anticancer Res 2007; 27:965-971.  Back to cited text no. 2
    
3.
Charo J, Finkelstein SE, Grewal N, Restifo NP, Robbins PF, Rosenberg SA. BCL-2 over expression enhances tumor-specific T cell survival. Cancer Res 2005; 65:2001-2008.  Back to cited text no. 3
    
4.
Bringmann G, Reichert Y, Kane VV. The total synthesis of streptonigrin and related antitumor antibiotic natural products. Tetrahedron 2004; 60:3539L.  Back to cited text no. 4
    
5.
Thirumurugan P, Mahalaxmi S, Perumal PT. Synthesis and anti-inflammatory activity of 3-indolyl pyridine derivatives through one-pot multi component reaction. J Chem Sci 2010; 122:819-832.  Back to cited text no. 5
    
6.
Mungra DC, Patel MP, Patel RG. An efficient one-pot synthesis and in vitro antimicrobial activity of new pyridine derivatives bearing the tetrazoloquinoline nucleus. ARKIVOC 2009; 64-74.  Back to cited text no. 6
    
7.
Khanage SG, Raju SA, Mohite PB, Pandhare RB. Synthesis and pharmacological evaluation of some new pyrimidine derivatives containing 1,2,4-triazole. Advanced Pharm Bull 2012; 2:213-222.  Back to cited text no. 7
    
8.
Tirlapur VK, Gandhi N, Basawaraj R, Prasad R. Synthesis, characterization and biological activities of some new pyrimidines and isoxazoles bearing benzofuran moiety. Int J Chem Tech Res 2010; 2:1434-1440.  Back to cited text no. 8
    
9.
Dhorajiya BD, Malani MH, Patel JR, Dholakiya BZ. Antimicrobial activities of synthesized and characterized 5-acetyl pyrimidine-2, 4, 6-(1H, 3H, 5H)-trione based chalcones. Der Pharma Chem 2012; 4:141-146.  Back to cited text no. 9
    
10.
Koca Ý, Özgür A, Coþkun KA, Tutar Y. Synthesis and anticancer activity of acyl thioureas bearing pyrazole moiety. Bioorg Med Chem 2013; 21:3859-3865.  Back to cited text no. 10
    
11.
Tewari AK, Srivastava P, Singh VP, Singh A, Goel RK, Mohan CG. Novel anti-inflammatory agents based on pyrazole based dimeric compounds; design, synthesis, docking and in vivo activity. Chem Pharm Bull 2010; 58:634-638.  Back to cited text no. 11
    
12.
Priyadarsinia P, Ujwalaa B, Rao CV, Rao VM. Synthesis and antimicrobial activity of some novel pyrazoles. Der Pharm Lett 2012; 4:1123-1128.  Back to cited text no. 12
    
13.
Saundane AR, Vijaykumar K, Vaijinath AV, Walmik P. Synthesis, antimicrobial and antioxidant activities of some new indole derivatives containing pyridopyrimidine and pyrazolopyridine moieties. Med Chem Res 2013; 22:806-817.  Back to cited text no. 13
    
14.
Kaur J, Bhardwaj A, Huang Z, Knaus EE. N-1 and C-3 substituted indole Schiff bases as selective COX-2 inhibitors: synthesis and biological evaluation. Bioorg Med Chem Lett 2012; 22:2154-2159.  Back to cited text no. 14
    
15.
Kumar D, Kumar NM, Akamatsu K, Kusaka E, Harada H, Ito T. Synthesis and biological evaluation of indolyl chalcones as antitumor agents. Bioorg Med Chem Lett 2010; 20:3916-3919.  Back to cited text no. 15
    
16.
Kumar D, Kumar NM, Ghosh S, Shah K. Novel bis(indolyl)hydrazide-hydrazones as potent cytotoxic agents. Biooorg Med Chem Lett 2012; 22:212-215.  Back to cited text no. 16
    
17.
Naik N, kumar HV, Shubhavathi T. Synthesis and antioxidant evaluation of novel 5-methoxy indole analogues. Inter J Curr Pharm Res 2011; 3:109-113.  Back to cited text no. 17
    
18.
El-Sawy ER, Mandour AH, Mahmoud NA, Mustafa M. Synthesis, antimicrobial and anti-inflammatory activities of some new N-substituted sulfonyl indole-3-heterocyclic derivatives. Egypt J Chem 2009; 52:541-553.  Back to cited text no. 18
    
19.
El-Sawy ER, Mandour AH, Khaled M, Islam IE, Abo-Salem HM. Synthesis, antimicrobial and anti-cancer activities of some new N-ethyl, N-benzyl and N-benzoyl-3-indolyl heterocycles. Acta Pharm 2012; 62:157-159.  Back to cited text no. 19
    
20.
El-Sawy ER, Mandour AH, El-Hallouty SM, Shaker KH, Abo-Salem HM. Synthesis, antimicrobial and anticancer activities of some new N-methylsulfonyl and N-benzenesulfonyl-3-indolyl heterocycles. Arabian J Chem 2013; 6:67-78.  Back to cited text no. 20
    
21.
Mandour AH, El-Sawy ER, Ebaid MS, Hassan SM. Synthesis and potential biological activity of some novel 3-[(N-substituted indol-3-yl)methyleneamino]-6-amino-4-aryl-pyrano(2,3-c)pyrazole-5- carbonitriles and 3,6-diamino-4-(N-substituted indol-3-yl)pyrano (2,3-c)pyrazole-5-carbonitriles. Acta Pharm 2012; 62:15-30.  Back to cited text no. 21
    
22.
Mndzhoyan AL, Papayan GL, Zhuruli LD, Karagezyan SG, Galstyan LS, Sarafyan VG. Synthesis and biological study of hydrazinohydrazones of indole aldehydes and ketones series. Arm Khim Zh (USSR) 1969; 22:707-713.  Back to cited text no. 22
    
23.
Aggarwal R, Benedetti F, Berti F, Buchini S, Colombatti A, Dinon F, et al. A catalytic antibodyprogrammed for trosional activation of amide bond hydrolysis. Chemistry 2003; 9:3132-3142.  Back to cited text no. 23
    
24.
Sonlnier MG, Gribble GW. Generation and reaction of 3-lithio-1-(phenylsulfonyl)indole. J Org Chem 1982; 47:757-761.  Back to cited text no. 24
    
25.
Mandour AH, El-Sawy ER, Zahran MA, Ebaid MS, Mustafa MA. Anti-inflammatory, analgesic, anticonvulsant and antimicrobial activities of some new synthesized N-alkyl-3-indolyl pyrimidines and benzimidazolo(1,2-α) pyrimidines. Biohealth Sci Bull (Malaysia) 2009; 1:57-67.  Back to cited text no. 25
    
26.
Repetto G, Peso AD, Zurita JL. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat Prot 2008; 3:1125-1131.  Back to cited text no. 26
    
27.
Porter J, Payne A, De Candole B, Ford D, Hutchinson B, Trevitt G, et al. Tetrahydroisoquinoline amide substituted phenyl pyrazoles as selective Bcl-2 inhibitors. Bioorg Med Chem Lett 2009; 19:230-233.  Back to cited text no. 27
    
28.
Kaminski G, Jorgensen WL. Performance of the AMBER94, MMFF94 and OPLS-AA forcefields for modeling organic liquids. J Phys Chem 1996; 100:18010-18013.  Back to cited text no. 28
    
29.
Lensink MF, Méndez R, Wodak SJ. Docking and scoring protein complexes: CAPRI 3rd Edition. Proteins 2007; 69:704-718.  Back to cited text no. 29
    
30.
Abdel Sayed NI. Uses of 4-phenyl-3-thiosemicarbazide in heterocyclic synthesis: synthesis of pyrazole, pyrazolo[3,2-c]-1,2,4-triazole derivatives. Egypt J Chem 1999; 42:175-187.  Back to cited text no. 30
    
31.
Chao D, Korsmeyer S. BCL-2 family: regulators of cell death. Annu Rev Immun 1998; 16:395-419.  Back to cited text no. 31
    
32.
Martinez-Caballero S, Dejean L, Jonas E, Kinnally K. The role of the mitochondrial apoptosis induced channel MAC in cytochrome c release. J Bioenerg Biomembr 2005; 37:155-164.  Back to cited text no. 32
    
33.
Lin YC, Tsai JY, Yang JS, Lee YH, Hamel E, Lee KH, et al. The novel synthetic compound 6-acetyl-9-(3,4,5-trimetho-xybenzyl)-9H-pyrido[2,3-b]indole induces mitotic arrest and apoptosis in human COLO 205 cells. Int J Oncol 2013; 43:1596-1606.  Back to cited text no. 33
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]
 
 
    Tables

  [Table 1], [Table 2]


This article has been cited by
1 Efficient Synthesis and Biological Activity of Novel Indole Derivatives as VEGFR-2 Tyrosine Kinase Inhibitors
C. Zhang,D. Xu,J. Wang,C. Kang
Russian Journal of General Chemistry. 2017; 87(12): 3006
[Pubmed] | [DOI]
2 Synthesis, biological activity and molecular modeling study of new Schiff bases incorporated with indole moiety
Ahmed H. Halawa,Shimaa Mohamed Abd El-Gilil,Ahmed H. Bedair,Mohamed Shaaban,Marcel Frese,Norbert Sewald,Essam M. Eliwa,Ahmed M. El-Agrody
Zeitschrift für Naturforschung C. 2017; 72(11-12)
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Experimental
Biological assay
Results and disc...
Biological assay
Conclusion
Acknowledgements
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1714    
    Printed96    
    Emailed0    
    PDF Downloaded302    
    Comments [Add]    
    Cited by others 2    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]